ID: 1047756903

View in Genome Browser
Species Human (GRCh38)
Location 8:127926084-127926106
Sequence GACCATGACTGGAGGGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047756903_1047756915 24 Left 1047756903 8:127926084-127926106 CCCACTTCCCTCCAGTCATGGTC No data
Right 1047756915 8:127926131-127926153 AGTGGTTCTTTTCCTGCCCCTGG No data
1047756903_1047756911 6 Left 1047756903 8:127926084-127926106 CCCACTTCCCTCCAGTCATGGTC No data
Right 1047756911 8:127926113-127926135 CGGCTCTCTTCTCCCCAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047756903 Original CRISPR GACCATGACTGGAGGGAAGT GGG (reversed) Intergenic
No off target data available for this crispr