ID: 1047757391

View in Genome Browser
Species Human (GRCh38)
Location 8:127929054-127929076
Sequence TGTTTATCTTGCTTCTAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047757391_1047757399 19 Left 1047757391 8:127929054-127929076 CCTACTTAGAAGCAAGATAAACA No data
Right 1047757399 8:127929096-127929118 CAGAAGCAAGGGGGGTTTAGCGG No data
1047757391_1047757402 24 Left 1047757391 8:127929054-127929076 CCTACTTAGAAGCAAGATAAACA No data
Right 1047757402 8:127929101-127929123 GCAAGGGGGGTTTAGCGGGTGGG No data
1047757391_1047757401 23 Left 1047757391 8:127929054-127929076 CCTACTTAGAAGCAAGATAAACA No data
Right 1047757401 8:127929100-127929122 AGCAAGGGGGGTTTAGCGGGTGG No data
1047757391_1047757396 9 Left 1047757391 8:127929054-127929076 CCTACTTAGAAGCAAGATAAACA No data
Right 1047757396 8:127929086-127929108 TACTTTGGGACAGAAGCAAGGGG No data
1047757391_1047757394 7 Left 1047757391 8:127929054-127929076 CCTACTTAGAAGCAAGATAAACA No data
Right 1047757394 8:127929084-127929106 TGTACTTTGGGACAGAAGCAAGG No data
1047757391_1047757395 8 Left 1047757391 8:127929054-127929076 CCTACTTAGAAGCAAGATAAACA No data
Right 1047757395 8:127929085-127929107 GTACTTTGGGACAGAAGCAAGGG No data
1047757391_1047757398 11 Left 1047757391 8:127929054-127929076 CCTACTTAGAAGCAAGATAAACA No data
Right 1047757398 8:127929088-127929110 CTTTGGGACAGAAGCAAGGGGGG No data
1047757391_1047757393 -5 Left 1047757391 8:127929054-127929076 CCTACTTAGAAGCAAGATAAACA No data
Right 1047757393 8:127929072-127929094 AAACATATGTATTGTACTTTGGG No data
1047757391_1047757397 10 Left 1047757391 8:127929054-127929076 CCTACTTAGAAGCAAGATAAACA No data
Right 1047757397 8:127929087-127929109 ACTTTGGGACAGAAGCAAGGGGG No data
1047757391_1047757404 30 Left 1047757391 8:127929054-127929076 CCTACTTAGAAGCAAGATAAACA No data
Right 1047757404 8:127929107-127929129 GGGGTTTAGCGGGTGGGAAAGGG No data
1047757391_1047757403 29 Left 1047757391 8:127929054-127929076 CCTACTTAGAAGCAAGATAAACA No data
Right 1047757403 8:127929106-127929128 GGGGGTTTAGCGGGTGGGAAAGG No data
1047757391_1047757400 20 Left 1047757391 8:127929054-127929076 CCTACTTAGAAGCAAGATAAACA No data
Right 1047757400 8:127929097-127929119 AGAAGCAAGGGGGGTTTAGCGGG No data
1047757391_1047757392 -6 Left 1047757391 8:127929054-127929076 CCTACTTAGAAGCAAGATAAACA No data
Right 1047757392 8:127929071-127929093 TAAACATATGTATTGTACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047757391 Original CRISPR TGTTTATCTTGCTTCTAAGT AGG (reversed) Intergenic
No off target data available for this crispr