ID: 1047757393

View in Genome Browser
Species Human (GRCh38)
Location 8:127929072-127929094
Sequence AAACATATGTATTGTACTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047757388_1047757393 16 Left 1047757388 8:127929033-127929055 CCTCAAGTATTTTAATATACCCC No data
Right 1047757393 8:127929072-127929094 AAACATATGTATTGTACTTTGGG No data
1047757389_1047757393 -3 Left 1047757389 8:127929052-127929074 CCCCTACTTAGAAGCAAGATAAA No data
Right 1047757393 8:127929072-127929094 AAACATATGTATTGTACTTTGGG No data
1047757391_1047757393 -5 Left 1047757391 8:127929054-127929076 CCTACTTAGAAGCAAGATAAACA No data
Right 1047757393 8:127929072-127929094 AAACATATGTATTGTACTTTGGG No data
1047757390_1047757393 -4 Left 1047757390 8:127929053-127929075 CCCTACTTAGAAGCAAGATAAAC No data
Right 1047757393 8:127929072-127929094 AAACATATGTATTGTACTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047757393 Original CRISPR AAACATATGTATTGTACTTT GGG Intergenic
No off target data available for this crispr