ID: 1047757402

View in Genome Browser
Species Human (GRCh38)
Location 8:127929101-127929123
Sequence GCAAGGGGGGTTTAGCGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047757390_1047757402 25 Left 1047757390 8:127929053-127929075 CCCTACTTAGAAGCAAGATAAAC No data
Right 1047757402 8:127929101-127929123 GCAAGGGGGGTTTAGCGGGTGGG No data
1047757391_1047757402 24 Left 1047757391 8:127929054-127929076 CCTACTTAGAAGCAAGATAAACA No data
Right 1047757402 8:127929101-127929123 GCAAGGGGGGTTTAGCGGGTGGG No data
1047757389_1047757402 26 Left 1047757389 8:127929052-127929074 CCCCTACTTAGAAGCAAGATAAA No data
Right 1047757402 8:127929101-127929123 GCAAGGGGGGTTTAGCGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047757402 Original CRISPR GCAAGGGGGGTTTAGCGGGT GGG Intergenic
No off target data available for this crispr