ID: 1047757806

View in Genome Browser
Species Human (GRCh38)
Location 8:127932018-127932040
Sequence CAACAGAGGAAGCCTGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047757806_1047757820 30 Left 1047757806 8:127932018-127932040 CCATCCTCAGGCTTCCTCTGTTG No data
Right 1047757820 8:127932071-127932093 ATGGAGGGCCTGGCCTTTGGCGG No data
1047757806_1047757812 11 Left 1047757806 8:127932018-127932040 CCATCCTCAGGCTTCCTCTGTTG No data
Right 1047757812 8:127932052-127932074 GATTCCTGGGAACACCACCATGG No data
1047757806_1047757815 15 Left 1047757806 8:127932018-127932040 CCATCCTCAGGCTTCCTCTGTTG No data
Right 1047757815 8:127932056-127932078 CCTGGGAACACCACCATGGAGGG No data
1047757806_1047757816 20 Left 1047757806 8:127932018-127932040 CCATCCTCAGGCTTCCTCTGTTG No data
Right 1047757816 8:127932061-127932083 GAACACCACCATGGAGGGCCTGG No data
1047757806_1047757810 -2 Left 1047757806 8:127932018-127932040 CCATCCTCAGGCTTCCTCTGTTG No data
Right 1047757810 8:127932039-127932061 TGAATTTTCTCCAGATTCCTGGG No data
1047757806_1047757809 -3 Left 1047757806 8:127932018-127932040 CCATCCTCAGGCTTCCTCTGTTG No data
Right 1047757809 8:127932038-127932060 TTGAATTTTCTCCAGATTCCTGG No data
1047757806_1047757813 14 Left 1047757806 8:127932018-127932040 CCATCCTCAGGCTTCCTCTGTTG No data
Right 1047757813 8:127932055-127932077 TCCTGGGAACACCACCATGGAGG No data
1047757806_1047757818 27 Left 1047757806 8:127932018-127932040 CCATCCTCAGGCTTCCTCTGTTG No data
Right 1047757818 8:127932068-127932090 ACCATGGAGGGCCTGGCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047757806 Original CRISPR CAACAGAGGAAGCCTGAGGA TGG (reversed) Intergenic
No off target data available for this crispr