ID: 1047758960

View in Genome Browser
Species Human (GRCh38)
Location 8:127939968-127939990
Sequence CTGAACCCTGCATTTTGTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 168}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047758960 Original CRISPR CTGAACCCTGCATTTTGTGG AGG Intergenic
901575591 1:10198315-10198337 CTCACCCCTCCAGTTTGTGGTGG + Intergenic
902163672 1:14552507-14552529 CTGCTCCCTGTATTTTCTGGTGG + Intergenic
908086028 1:60634964-60634986 CTGAGCCCTGTCTGTTGTGGAGG - Intergenic
908511249 1:64851560-64851582 CTTAAACCTGCATATTGAGGGGG - Intronic
909118441 1:71569653-71569675 CTGAATTCTGCATTTAGTGAGGG - Intronic
910583408 1:88853135-88853157 CTCAACCCAGCATTTTGTATAGG + Exonic
910944248 1:92571800-92571822 CAGAAACCTGCATTTTCTTGAGG + Intronic
913162528 1:116157224-116157246 CTGAACTCTTGATTTTGTGAAGG + Intergenic
917527485 1:175801957-175801979 CTTAAACCTGTATTTTTTGGAGG + Intergenic
918975333 1:191476690-191476712 TTAAATCCTGCATTGTGTGGGGG - Intergenic
919370473 1:196718479-196718501 CTGAATCCTGGATTTAGTGGAGG + Intronic
923541218 1:234889605-234889627 ATGACCCCTGCATTTTGGGAAGG + Intergenic
924741921 1:246799179-246799201 CTGCACACTGCAGTCTGTGGAGG - Intergenic
1063129519 10:3165870-3165892 ATGAACAGTGCATTCTGTGGGGG - Intronic
1064816394 10:19269654-19269676 CTGAACTTTGCAATTGGTGGTGG - Intronic
1065498628 10:26355828-26355850 CTGAATGCTGCATTCTGTGGAGG + Intergenic
1067260523 10:44686051-44686073 CTGGATCCTGCATTTTGTGATGG - Intergenic
1067542707 10:47167273-47167295 GTAATCCCTGCATTTTGGGGGGG + Intergenic
1070313204 10:75288530-75288552 CTGAACCTTGCCTTTTGTGTTGG + Intergenic
1071023305 10:81083457-81083479 CTGATCACTTCATTTGGTGGTGG - Intergenic
1071051280 10:81451489-81451511 CTGAACTATGCATTTTAAGGGGG - Intergenic
1072771536 10:98144046-98144068 GTAATCCCAGCATTTTGTGGGGG + Intronic
1075786283 10:125052372-125052394 CTGCTCCCTGCGTGTTGTGGGGG - Intronic
1075879290 10:125836373-125836395 CAGAACCCTACTTTTTGTAGAGG - Exonic
1077532710 11:3104648-3104670 CTGCACCCTGGACTTTGAGGAGG - Intronic
1081990392 11:47334208-47334230 CTGATCCCTGCCTTTTGAAGTGG - Intronic
1083318315 11:61829474-61829496 CTGAGCCACGCATTTGGTGGGGG - Intronic
1084921512 11:72474525-72474547 CTGAAGCCTGGATTCAGTGGTGG + Intergenic
1086268842 11:85035035-85035057 CTGACCTCTGTATTTTGTGAGGG - Intronic
1086625856 11:88951457-88951479 CTGAACTCTCTATTTTGTGTTGG + Intronic
1090000383 11:122951323-122951345 CTGAAGCAGTCATTTTGTGGTGG - Intronic
1090562342 11:127946039-127946061 CTAAACCCTGTTTTTTTTGGGGG - Intergenic
1090965304 11:131592834-131592856 CTGAGCCCAGCATTGTGGGGAGG - Intronic
1091079853 11:132656090-132656112 CCGAACCTTTCATTTGGTGGAGG + Intronic
1091452102 12:578962-578984 CTGAACCTTAGATTTTGTGATGG + Intronic
1092010876 12:5111625-5111647 GTGAACTCTGCTTTTTGTGGAGG + Intergenic
1094798679 12:34004170-34004192 CATAACCCCACATTTTGTGGAGG - Intergenic
1098954000 12:76669911-76669933 CTGTACCCTGCAGTCTGTGTGGG - Intergenic
1100705686 12:97197843-97197865 CTGTGCCTTGCATTTTCTGGTGG + Intergenic
1103371338 12:120421875-120421897 CTAAACTCTACCTTTTGTGGAGG + Intergenic
1105513100 13:21067469-21067491 CTGAACACTGCAGTTTATGGAGG - Intergenic
1108060633 13:46529538-46529560 CTGCAGCCTGCATGGTGTGGGGG - Intergenic
1108260173 13:48648025-48648047 CTGTACCATGGGTTTTGTGGAGG + Intergenic
1108708744 13:53013423-53013445 CTGACCCATGCATATTATGGAGG + Intergenic
1110313339 13:74076436-74076458 CTTGACCCTGCATTCTTTGGAGG + Intronic
1112572840 13:100609144-100609166 CTGAAGTCTGCACTTGGTGGTGG + Intronic
1112972044 13:105273234-105273256 CTGAACCCTTCAGTCGGTGGTGG - Intergenic
1116805890 14:49493860-49493882 CTGGATCATGCAGTTTGTGGAGG + Intergenic
1117837231 14:59819701-59819723 CCGAACCCTGCCTTGTGGGGAGG + Intronic
1119184988 14:72634072-72634094 CTTAGTCCTGCATTTTGTCGGGG - Intronic
1120081212 14:80218674-80218696 CCAAACACTGCATTTTGTTGAGG - Intronic
1124103093 15:26713473-26713495 CTGAACCCAGCATTGTGTTTCGG - Intronic
1124143243 15:27096145-27096167 CAGAACCCTGCTTTGTGTGACGG - Intronic
1126233405 15:46354123-46354145 CTGAACACTTCAGTTGGTGGTGG + Intergenic
1126555278 15:49980684-49980706 CTGAACCCTGCAAATTATGTAGG - Intronic
1131833061 15:96366437-96366459 CTGGACCCTGACTTTTTTGGAGG - Intergenic
1132826399 16:1907635-1907657 CTGACCCCTGCCCTCTGTGGGGG - Intergenic
1132958380 16:2608687-2608709 CTGGACCCTGCACTGTGGGGAGG + Intergenic
1132970992 16:2688783-2688805 CTGGACCCTGCACTGTGGGGAGG + Intronic
1136292404 16:29283525-29283547 CTGGACCCTGCCTTTGGTGCTGG + Intergenic
1137002766 16:35245725-35245747 GTGAAACCTGCATTTTGTAGAGG - Intergenic
1137012304 16:35335093-35335115 GTGAACCTTGCATTTTGTAGAGG - Intergenic
1137019052 16:35405547-35405569 GTGAACCCTGCATTTTGTAGAGG - Intergenic
1137232783 16:46583072-46583094 CTGAAGGCTGCATTTCCTGGAGG - Intronic
1137632497 16:49956877-49956899 CTGAACCGGGCCTTTTGTGAAGG + Intergenic
1139328537 16:66170029-66170051 CTGAACCCTGAACCTTGTTGAGG - Intergenic
1141814799 16:86402293-86402315 CTGAACCCTGCAATATTTGCAGG - Intergenic
1142052241 16:87966280-87966302 CTGAGCCCTGCATCTCTTGGTGG + Intronic
1143479309 17:7219503-7219525 CTGTACCCTCCCTTTTGTGTTGG + Exonic
1144052817 17:11511575-11511597 CTGAACCAGGCATTTTTTTGGGG - Intronic
1144630118 17:16867157-16867179 CTGAGCCCAGCATTTGGTGAGGG + Intergenic
1144651258 17:17008639-17008661 CTGAGCCCAGCATTTGGTGAGGG - Intergenic
1144841043 17:18185960-18185982 CTCAACCTTGTATTTGGTGGTGG - Intronic
1149315569 17:55435225-55435247 CTGCACTGTGCATATTGTGGGGG + Intergenic
1149437591 17:56646289-56646311 CTGTACCTTGGATTTTATGGAGG - Intergenic
1151885921 17:76923394-76923416 CTGAACCCTGAATCCTGGGGAGG + Intronic
1152463413 17:80452852-80452874 CTGAATCCTGCATTTAGTAGTGG + Intergenic
1152868580 17:82738328-82738350 CTGCACCCTGCCCTCTGTGGTGG + Intronic
1153191134 18:2540103-2540125 CTGAACATTGTATTTTGTTGGGG + Intronic
1153456787 18:5291614-5291636 CTGAACCCTGAGCGTTGTGGTGG + Exonic
1154991488 18:21601557-21601579 CGAAGCCCTGCATTTTTTGGAGG - Intergenic
1155733236 18:29188500-29188522 CTGACACCTGCATTTTATGGGGG + Intergenic
1155930935 18:31707708-31707730 ATGAACCATGCATAATGTGGGGG - Intergenic
1157695810 18:49722668-49722690 CTGAACCCTATATCTTGGGGTGG - Intergenic
1159981376 18:74785354-74785376 CTGAGCCCTGAAATTTGTGCTGG + Intronic
1160030061 18:75250085-75250107 CTCATCCCTGCAGTTGGTGGGGG + Intronic
1160030072 18:75250125-75250147 CTGACCCCTGCAGTAGGTGGGGG + Intronic
1162742027 19:12778840-12778862 CATAACCCTCCATTTTGCGGCGG + Intronic
1164866472 19:31608403-31608425 CAGAACCATGCACTTTTTGGTGG - Intergenic
1166233556 19:41440106-41440128 GTGAACCCAGCACTTTGTGGAGG + Intronic
1166519346 19:43469832-43469854 GTAATCCCAGCATTTTGTGGGGG + Intergenic
926024411 2:9528658-9528680 CAGAACCAGGCAGTTTGTGGGGG + Intronic
934474361 2:94583807-94583829 CTAATCCCAGCACTTTGTGGGGG - Intergenic
936679036 2:114749872-114749894 CTTAACACAGCATTATGTGGAGG - Intronic
937969264 2:127536737-127536759 CAGAACCCTGCACTTTGTTTAGG + Intronic
940453343 2:153868229-153868251 CTGAACCCTAAGTTTTGTGCAGG + Intergenic
941891721 2:170589131-170589153 CTAAACCCTGAATTTTCTTGGGG - Intronic
943947848 2:194090522-194090544 CTGAGCCCTGCCTTATGGGGAGG + Intergenic
945357482 2:208857104-208857126 CTGAACACTGCAGTTGGTGGTGG - Intergenic
945425344 2:209694061-209694083 CTGTACCCTGCTTCTTGTGCTGG - Exonic
945427297 2:209722648-209722670 TTGAACCTTGCATCTTTTGGAGG - Intronic
945845812 2:214943400-214943422 GTAATCCCTGCACTTTGTGGGGG - Intronic
946619020 2:221541025-221541047 CTGAACCCAGGAGTTTGAGGTGG - Intronic
1170356090 20:15493080-15493102 CTGAAAAATGTATTTTGTGGTGG - Intronic
1172272028 20:33660152-33660174 CTGGAGCCTGCATTTTCGGGCGG - Intronic
1173600117 20:44288841-44288863 CTGAAACCTGGACTTAGTGGTGG - Intergenic
1174335506 20:49857035-49857057 TTGAACTCTGCATTTTATGGTGG + Intronic
1177791277 21:25724369-25724391 CATAACCCTGCTTGTTGTGGAGG - Intronic
1179298000 21:40080399-40080421 CTGATGCTTGCATTTTGTGTGGG + Intronic
1182561386 22:31162196-31162218 CTCAACCCTAACTTTTGTGGCGG - Intronic
1184336368 22:43855510-43855532 CTAAACCAGTCATTTTGTGGGGG - Intronic
1184776835 22:46627540-46627562 CAGAAACTTGCATTTGGTGGGGG + Intronic
949634754 3:5970467-5970489 CTCAAGGATGCATTTTGTGGAGG - Intergenic
950285899 3:11744436-11744458 GTAATCCCTGCACTTTGTGGGGG + Intergenic
950500730 3:13361936-13361958 CTGAGCCCTGCAGTGTGAGGAGG - Intronic
953500640 3:43430432-43430454 GTCAACCTTGAATTTTGTGGTGG + Intronic
957720552 3:83992266-83992288 CTGAATCTTGCATTTTGTATTGG + Intergenic
957749035 3:84388374-84388396 TTGAACTCTTCATTTTTTGGAGG + Intergenic
958894527 3:99815118-99815140 CTGACCCCTGCAGTCTTTGGAGG - Intergenic
959525583 3:107372794-107372816 CTGGCCCCTAAATTTTGTGGGGG + Intergenic
960460372 3:117927071-117927093 CAGCAACCTGCATTTTGAGGGGG + Intergenic
960602537 3:119471898-119471920 GTGATCCCAGCACTTTGTGGTGG + Intronic
962098089 3:132313139-132313161 CTCAAACCATCATTTTGTGGAGG - Intergenic
962183295 3:133231484-133231506 CTGAAGCCACCATGTTGTGGGGG - Intronic
962945261 3:140163375-140163397 TTGATTCATGCATTTTGTGGGGG - Intronic
963533672 3:146501761-146501783 TTGAACCCTGCATAATCTGGAGG + Intergenic
964455944 3:156866377-156866399 CTGTCCTCTGCATTTTGGGGAGG - Intronic
965310133 3:167116578-167116600 CTGAACCCTCCCTGTTGCGGTGG + Intergenic
966128540 3:176608511-176608533 AAAAACCCTGCATGTTGTGGTGG - Intergenic
970705540 4:18797273-18797295 CTGCACCCTGCATGTTGGAGTGG - Intergenic
970969141 4:21961184-21961206 CTGAAACCAGCATTTTATGATGG + Intergenic
977872294 4:102106564-102106586 GTAATCCCAGCATTTTGTGGGGG + Intergenic
979528227 4:121740076-121740098 TTGAACACTGCATATGGTGGAGG + Intergenic
983776528 4:171614874-171614896 AGGAACACTGCATTGTGTGGGGG - Intergenic
986868348 5:12016275-12016297 CTGAACCCAGCCCTGTGTGGAGG + Intergenic
988443406 5:31257763-31257785 CTCATCCCTTCAATTTGTGGGGG + Intronic
989195706 5:38714262-38714284 CTGACCCCAACATTTTGTGTTGG - Intergenic
991429969 5:66534224-66534246 CTGATGCCTGCAATTAGTGGAGG + Intergenic
994176450 5:96717229-96717251 CTGAACCATGCATTCTGTGTTGG - Intronic
998336592 5:141377112-141377134 CTGAAGTCTTAATTTTGTGGGGG + Intronic
998493822 5:142569631-142569653 CTGAACCCTGATTATGGTGGTGG - Intergenic
998845547 5:146305989-146306011 ATGTACCCTGCAGATTGTGGCGG + Intronic
999644909 5:153707996-153708018 CTGACACCTGCATGTTGTGATGG - Intronic
1002194483 5:177494759-177494781 CTGGACCCTGCATGAGGTGGGGG + Intronic
1007653347 6:43436794-43436816 CTCAACCCGGCATTCTCTGGTGG + Intronic
1009972832 6:70643158-70643180 GTAATCCCTGCACTTTGTGGGGG - Intergenic
1012921582 6:105225610-105225632 CTGACCCCTGCCTTTCGTGGTGG - Intergenic
1016450879 6:144181010-144181032 CTGATCCCTTCATTTTATGATGG - Intronic
1017022058 6:150148251-150148273 CTGAGACCCCCATTTTGTGGAGG + Intronic
1018916237 6:168134260-168134282 CTGAACCCTGGAAAGTGTGGTGG + Intergenic
1019217316 6:170452273-170452295 CTGAGCCCTGCAGGTTCTGGAGG - Intergenic
1020910792 7:14127941-14127963 CTGAACAATGCATTTTGTGCTGG - Intergenic
1022298952 7:29084369-29084391 CAGAACCCTGAATGATGTGGTGG - Intronic
1023887896 7:44374185-44374207 CTGTATGCTGCATTGTGTGGGGG + Intergenic
1024971476 7:55075319-55075341 CTGAACCCTTCTTTGTATGGAGG + Intronic
1025274863 7:57571197-57571219 CTGAATACTGCATTTTGCAGAGG + Intergenic
1029051045 7:97687920-97687942 CTGTACACTACATTTTGTGGGGG - Intergenic
1035797977 8:2376654-2376676 GTGACCCCTGCATATTCTGGAGG - Intergenic
1037574574 8:20189231-20189253 CTGAACTCTTCTTTTTGTTGAGG + Intergenic
1042164174 8:65929739-65929761 CTGAATCCTTCCTTTTCTGGAGG - Intergenic
1046903068 8:119543422-119543444 CTGCAGCCTGCATGTGGTGGAGG + Intergenic
1047520158 8:125589911-125589933 CTGACCCCTGATGTTTGTGGAGG + Intergenic
1047550888 8:125871175-125871197 TTGAACCCTGCATTTTTCTGAGG + Intergenic
1047758960 8:127939968-127939990 CTGAACCCTGCATTTTGTGGAGG + Intergenic
1047939594 8:129816295-129816317 CTGAACACTGCAGTTGGTTGTGG - Intergenic
1048286963 8:133149320-133149342 CTGAATCCTGCATTGTTGGGAGG + Intergenic
1048863977 8:138745815-138745837 CTGAATCCTGAATGTTTTGGCGG - Intronic
1049244436 8:141554465-141554487 CTGAACACTGCACTTGGAGGAGG + Intergenic
1052347263 9:27422319-27422341 CTGAACTATGCATTTAATGGTGG - Intronic
1053277071 9:36791184-36791206 CTGAAGCTACCATTTTGTGGAGG - Intergenic
1053683711 9:40502302-40502324 CTAATCCCAGCACTTTGTGGGGG + Intergenic
1055434344 9:76277273-76277295 CTGAAGCCTTCATTCTTTGGGGG - Intronic
1056262833 9:84865612-84865634 CTGAAACATGCATTTAGTAGGGG + Intronic
1057102865 9:92379796-92379818 CCGAAGCCTGCATTTTTTTGTGG + Exonic
1057256536 9:93553209-93553231 CTGACCCCTGTGTTTTGAGGAGG + Intronic
1058225918 9:102363122-102363144 CTGAACTCTTCAGATTGTGGTGG + Intergenic
1059176551 9:112174435-112174457 CTCAACACTGCATTTTGCAGAGG + Intronic
1059610267 9:115884665-115884687 CTGGACCCTGATTTCTGTGGAGG - Intergenic
1059779141 9:117508176-117508198 CTGAACACTTCAGTTGGTGGTGG - Intergenic
1185629019 X:1502628-1502650 CTGAGCCCTGCTATTTGGGGAGG + Intronic
1186637440 X:11421688-11421710 CTGAATCCTACATTTTGTAGGGG + Intronic
1187701022 X:21964454-21964476 CAGACCCCTGCATTCTGAGGGGG + Intronic
1188100706 X:26080318-26080340 CTGATCCCTGCATTCTATGAAGG + Intergenic
1189112770 X:38310571-38310593 CTGTTCCCTGCGTTCTGTGGTGG - Intronic
1189975542 X:46458322-46458344 CTGTATACAGCATTTTGTGGTGG + Intronic
1190770512 X:53510260-53510282 CTGCAAACTGCCTTTTGTGGAGG + Intergenic
1194774180 X:97943063-97943085 CTGAACCATGCATGTAGTGGGGG + Intergenic
1198029248 X:132738912-132738934 CTAGACCCTGGATTTTGTGGAGG + Intronic
1198403213 X:136287582-136287604 CTGAAGCCAGCAATTTCTGGAGG - Intergenic
1198839556 X:140841738-140841760 CTGATGCCTGCTTTTTTTGGGGG + Intergenic