ID: 1047760003

View in Genome Browser
Species Human (GRCh38)
Location 8:127947493-127947515
Sequence AGGCTCAGTGTGCCTGGCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047760003_1047760014 23 Left 1047760003 8:127947493-127947515 CCAATGCCAGGCACACTGAGCCT No data
Right 1047760014 8:127947539-127947561 CAGGTTTCTCCCCTCCCAGGTGG No data
1047760003_1047760015 24 Left 1047760003 8:127947493-127947515 CCAATGCCAGGCACACTGAGCCT No data
Right 1047760015 8:127947540-127947562 AGGTTTCTCCCCTCCCAGGTGGG No data
1047760003_1047760010 -3 Left 1047760003 8:127947493-127947515 CCAATGCCAGGCACACTGAGCCT No data
Right 1047760010 8:127947513-127947535 CCTGTAGGGATTTACAAGGTGGG No data
1047760003_1047760016 30 Left 1047760003 8:127947493-127947515 CCAATGCCAGGCACACTGAGCCT No data
Right 1047760016 8:127947546-127947568 CTCCCCTCCCAGGTGGGCATAGG No data
1047760003_1047760007 -7 Left 1047760003 8:127947493-127947515 CCAATGCCAGGCACACTGAGCCT No data
Right 1047760007 8:127947509-127947531 TGAGCCTGTAGGGATTTACAAGG No data
1047760003_1047760011 4 Left 1047760003 8:127947493-127947515 CCAATGCCAGGCACACTGAGCCT No data
Right 1047760011 8:127947520-127947542 GGATTTACAAGGTGGGCCTCAGG No data
1047760003_1047760013 20 Left 1047760003 8:127947493-127947515 CCAATGCCAGGCACACTGAGCCT No data
Right 1047760013 8:127947536-127947558 CCTCAGGTTTCTCCCCTCCCAGG No data
1047760003_1047760008 -4 Left 1047760003 8:127947493-127947515 CCAATGCCAGGCACACTGAGCCT No data
Right 1047760008 8:127947512-127947534 GCCTGTAGGGATTTACAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047760003 Original CRISPR AGGCTCAGTGTGCCTGGCAT TGG (reversed) Intergenic
No off target data available for this crispr