ID: 1047761378

View in Genome Browser
Species Human (GRCh38)
Location 8:127957157-127957179
Sequence CAGGTTGCACAGCTTGGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047761368_1047761378 29 Left 1047761368 8:127957105-127957127 CCTATTTTGCACATGTGGAAGTG No data
Right 1047761378 8:127957157-127957179 CAGGTTGCACAGCTTGGGGATGG No data
1047761371_1047761378 -8 Left 1047761371 8:127957142-127957164 CCAAGTCACTTGCCCCAGGTTGC No data
Right 1047761378 8:127957157-127957179 CAGGTTGCACAGCTTGGGGATGG No data
1047761367_1047761378 30 Left 1047761367 8:127957104-127957126 CCCTATTTTGCACATGTGGAAGT No data
Right 1047761378 8:127957157-127957179 CAGGTTGCACAGCTTGGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047761378 Original CRISPR CAGGTTGCACAGCTTGGGGA TGG Intergenic
No off target data available for this crispr