ID: 1047763262

View in Genome Browser
Species Human (GRCh38)
Location 8:127969839-127969861
Sequence CCTCTATGTCAGACAGGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047763262_1047763272 24 Left 1047763262 8:127969839-127969861 CCCTGGCCTGTCTGACATAGAGG No data
Right 1047763272 8:127969886-127969908 TTGTCTGCAGAGGACAGAGCAGG No data
1047763262_1047763267 -7 Left 1047763262 8:127969839-127969861 CCCTGGCCTGTCTGACATAGAGG No data
Right 1047763267 8:127969855-127969877 ATAGAGGCCACTATTGGCCCAGG No data
1047763262_1047763271 14 Left 1047763262 8:127969839-127969861 CCCTGGCCTGTCTGACATAGAGG No data
Right 1047763271 8:127969876-127969898 GGACAAAAGCTTGTCTGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047763262 Original CRISPR CCTCTATGTCAGACAGGCCA GGG (reversed) Intergenic
No off target data available for this crispr