ID: 1047763264

View in Genome Browser
Species Human (GRCh38)
Location 8:127969840-127969862
Sequence GCCTCTATGTCAGACAGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047763264_1047763271 13 Left 1047763264 8:127969840-127969862 CCTGGCCTGTCTGACATAGAGGC No data
Right 1047763271 8:127969876-127969898 GGACAAAAGCTTGTCTGCAGAGG No data
1047763264_1047763272 23 Left 1047763264 8:127969840-127969862 CCTGGCCTGTCTGACATAGAGGC No data
Right 1047763272 8:127969886-127969908 TTGTCTGCAGAGGACAGAGCAGG No data
1047763264_1047763267 -8 Left 1047763264 8:127969840-127969862 CCTGGCCTGTCTGACATAGAGGC No data
Right 1047763267 8:127969855-127969877 ATAGAGGCCACTATTGGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047763264 Original CRISPR GCCTCTATGTCAGACAGGCC AGG (reversed) Intergenic
No off target data available for this crispr