ID: 1047763267

View in Genome Browser
Species Human (GRCh38)
Location 8:127969855-127969877
Sequence ATAGAGGCCACTATTGGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047763264_1047763267 -8 Left 1047763264 8:127969840-127969862 CCTGGCCTGTCTGACATAGAGGC No data
Right 1047763267 8:127969855-127969877 ATAGAGGCCACTATTGGCCCAGG No data
1047763260_1047763267 16 Left 1047763260 8:127969816-127969838 CCAGTGCAAGTGCTGGGATTGAA No data
Right 1047763267 8:127969855-127969877 ATAGAGGCCACTATTGGCCCAGG No data
1047763262_1047763267 -7 Left 1047763262 8:127969839-127969861 CCCTGGCCTGTCTGACATAGAGG No data
Right 1047763267 8:127969855-127969877 ATAGAGGCCACTATTGGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047763267 Original CRISPR ATAGAGGCCACTATTGGCCC AGG Intergenic
No off target data available for this crispr