ID: 1047763271

View in Genome Browser
Species Human (GRCh38)
Location 8:127969876-127969898
Sequence GGACAAAAGCTTGTCTGCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047763264_1047763271 13 Left 1047763264 8:127969840-127969862 CCTGGCCTGTCTGACATAGAGGC No data
Right 1047763271 8:127969876-127969898 GGACAAAAGCTTGTCTGCAGAGG No data
1047763265_1047763271 8 Left 1047763265 8:127969845-127969867 CCTGTCTGACATAGAGGCCACTA No data
Right 1047763271 8:127969876-127969898 GGACAAAAGCTTGTCTGCAGAGG No data
1047763262_1047763271 14 Left 1047763262 8:127969839-127969861 CCCTGGCCTGTCTGACATAGAGG No data
Right 1047763271 8:127969876-127969898 GGACAAAAGCTTGTCTGCAGAGG No data
1047763268_1047763271 -9 Left 1047763268 8:127969862-127969884 CCACTATTGGCCCAGGACAAAAG No data
Right 1047763271 8:127969876-127969898 GGACAAAAGCTTGTCTGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047763271 Original CRISPR GGACAAAAGCTTGTCTGCAG AGG Intergenic
No off target data available for this crispr