ID: 1047771389

View in Genome Browser
Species Human (GRCh38)
Location 8:128032893-128032915
Sequence CTCTTTTGCTAGCACTCCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047771385_1047771389 1 Left 1047771385 8:128032869-128032891 CCCTTTCCAAGCTTCTGCTGGCC No data
Right 1047771389 8:128032893-128032915 CTCTTTTGCTAGCACTCCATTGG No data
1047771382_1047771389 20 Left 1047771382 8:128032850-128032872 CCACTCCTAGGTGAGTAAGCCCT No data
Right 1047771389 8:128032893-128032915 CTCTTTTGCTAGCACTCCATTGG No data
1047771383_1047771389 15 Left 1047771383 8:128032855-128032877 CCTAGGTGAGTAAGCCCTTTCCA No data
Right 1047771389 8:128032893-128032915 CTCTTTTGCTAGCACTCCATTGG No data
1047771386_1047771389 0 Left 1047771386 8:128032870-128032892 CCTTTCCAAGCTTCTGCTGGCCT No data
Right 1047771389 8:128032893-128032915 CTCTTTTGCTAGCACTCCATTGG No data
1047771387_1047771389 -5 Left 1047771387 8:128032875-128032897 CCAAGCTTCTGCTGGCCTCTCTT No data
Right 1047771389 8:128032893-128032915 CTCTTTTGCTAGCACTCCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047771389 Original CRISPR CTCTTTTGCTAGCACTCCAT TGG Intergenic
No off target data available for this crispr