ID: 1047773330

View in Genome Browser
Species Human (GRCh38)
Location 8:128048599-128048621
Sequence GGTCTGACTCACCATCAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 65}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047773330_1047773336 -9 Left 1047773330 8:128048599-128048621 CCCATCTGATGGTGAGTCAGACC 0: 1
1: 0
2: 0
3: 8
4: 65
Right 1047773336 8:128048613-128048635 AGTCAGACCTGCTGGGGTTTGGG No data
1047773330_1047773341 26 Left 1047773330 8:128048599-128048621 CCCATCTGATGGTGAGTCAGACC 0: 1
1: 0
2: 0
3: 8
4: 65
Right 1047773341 8:128048648-128048670 CATGGCTGCCTGTGTGACCTTGG No data
1047773330_1047773338 8 Left 1047773330 8:128048599-128048621 CCCATCTGATGGTGAGTCAGACC 0: 1
1: 0
2: 0
3: 8
4: 65
Right 1047773338 8:128048630-128048652 TTTGGGTCCTCGCTCCAGCATGG No data
1047773330_1047773335 -10 Left 1047773330 8:128048599-128048621 CCCATCTGATGGTGAGTCAGACC 0: 1
1: 0
2: 0
3: 8
4: 65
Right 1047773335 8:128048612-128048634 GAGTCAGACCTGCTGGGGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047773330 Original CRISPR GGTCTGACTCACCATCAGAT GGG (reversed) Intergenic