ID: 1047773330

View in Genome Browser
Species Human (GRCh38)
Location 8:128048599-128048621
Sequence GGTCTGACTCACCATCAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 65}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047773330_1047773336 -9 Left 1047773330 8:128048599-128048621 CCCATCTGATGGTGAGTCAGACC 0: 1
1: 0
2: 0
3: 8
4: 65
Right 1047773336 8:128048613-128048635 AGTCAGACCTGCTGGGGTTTGGG No data
1047773330_1047773341 26 Left 1047773330 8:128048599-128048621 CCCATCTGATGGTGAGTCAGACC 0: 1
1: 0
2: 0
3: 8
4: 65
Right 1047773341 8:128048648-128048670 CATGGCTGCCTGTGTGACCTTGG No data
1047773330_1047773338 8 Left 1047773330 8:128048599-128048621 CCCATCTGATGGTGAGTCAGACC 0: 1
1: 0
2: 0
3: 8
4: 65
Right 1047773338 8:128048630-128048652 TTTGGGTCCTCGCTCCAGCATGG No data
1047773330_1047773335 -10 Left 1047773330 8:128048599-128048621 CCCATCTGATGGTGAGTCAGACC 0: 1
1: 0
2: 0
3: 8
4: 65
Right 1047773335 8:128048612-128048634 GAGTCAGACCTGCTGGGGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047773330 Original CRISPR GGTCTGACTCACCATCAGAT GGG (reversed) Intergenic
902545301 1:17186124-17186146 GCTATGCCTCCCCATCAGATTGG + Intergenic
905282749 1:36859636-36859658 TGTCTGGATCCCCATCAGATGGG + Intronic
906842339 1:49152953-49152975 TGTCTGCCTCACAATCAGAATGG + Intronic
915087066 1:153396094-153396116 GGACTGTCTCCCTATCAGATAGG + Intergenic
920857272 1:209673482-209673504 AGGCTGACTCACCTTCAGAATGG + Intergenic
922739473 1:228007189-228007211 AGGCTCACTCACCACCAGATCGG - Exonic
1065847485 10:29758040-29758062 GAGCTGACTCACCCTCAGGTGGG - Intergenic
1066066105 10:31762030-31762052 GCTCTGCCTCAACATCACATTGG - Intergenic
1071757216 10:88556514-88556536 GATTTTACTCTCCATCAGATGGG - Intronic
1072764055 10:98081837-98081859 GGGATGACTCTCCACCAGATGGG + Intergenic
1075649593 10:124118974-124118996 GGGCTGACTCACCTGCAGTTGGG - Intergenic
1077561371 11:3263735-3263757 GCTCTGCCTCTCCATCAGCTTGG - Intergenic
1077567267 11:3309564-3309586 GCTCTGCCTCTCCATCAGCTTGG - Intergenic
1078952322 11:16148196-16148218 GGTCTAACTCAACAACTGATTGG - Intronic
1086433854 11:86762440-86762462 GTTTTGACTTACCACCAGATAGG + Intergenic
1096427948 12:51520223-51520245 GCTCTAAGGCACCATCAGATGGG + Intergenic
1097907137 12:64931932-64931954 GCTCTGACTCTCCTTCAGAAGGG + Intergenic
1102759585 12:115374105-115374127 GGTCAGACTCTCCCACAGATTGG + Intergenic
1112340176 13:98546538-98546560 GGCCTCACTCACCACCAGATGGG + Intronic
1202887007 14_KI270722v1_random:117180-117202 GGTCTGACTGTCCCTCACATAGG - Intergenic
1125826904 15:42684400-42684422 GCCCTGGCTCACCATCTGATGGG - Exonic
1135109214 16:19677661-19677683 TGTCTGTCTCACCAGCAGCTCGG - Intronic
1135118436 16:19743726-19743748 TGTGTGACTGACCATCAGAGTGG - Intronic
1140789590 16:78378349-78378371 GGTCAAACTCCCCATCAGACTGG + Intronic
1141818907 16:86431748-86431770 GGTCTGACTCAGCACCAGAGTGG + Intergenic
1142904844 17:3034638-3034660 GGTCTGACCCACACCCAGATGGG - Exonic
1143916370 17:10296319-10296341 GGTCTTCCACACCATAAGATAGG - Intergenic
1145202497 17:20959213-20959235 GGTCTGTTTCACCATCATCTGGG - Intergenic
1146180635 17:30696097-30696119 GGGCATAATCACCATCAGATGGG - Intergenic
1146948491 17:36890192-36890214 TATCTGACTCCCCATCAAATAGG + Intergenic
1147433671 17:40392646-40392668 GGTCTGATTCAGAATCAGATAGG - Exonic
1148519954 17:48263825-48263847 GGTCCGACTGTCCATCAGACTGG - Intronic
1162977950 19:14219436-14219458 GGGCATAATCACCATCAGATGGG + Intergenic
1168720415 19:58551684-58551706 GGTCTGCATCAGCATCAGCTAGG + Exonic
1202662427 1_KI270708v1_random:84125-84147 GGTCTGACTGTCCCTCACATAGG - Intergenic
927192087 2:20523908-20523930 GGTCTGGCTCACCAGAAGTTAGG - Intergenic
932477408 2:72014874-72014896 GTTCTGCCTCACCATCAGAGGGG - Intergenic
938114863 2:128596074-128596096 GCTCTGCCTCACCATCAGTAGGG - Intergenic
942111236 2:172684540-172684562 GGACTGACTCATCTCCAGATTGG - Intergenic
948368241 2:237472496-237472518 GGTCTGGCGCATCATCAAATTGG + Intergenic
1170869133 20:20188475-20188497 GGTCAGACTCATCATCTCATAGG - Intronic
1172576753 20:36015062-36015084 GGTATGACTCAACATCTCATTGG + Intronic
1175387553 20:58606857-58606879 AATGTGACTCTCCATCAGATTGG - Intergenic
1176626706 21:9097521-9097543 GGTCTGAATGACCCTCACATAGG + Intergenic
1180329242 22:11461668-11461690 GGTCTGACTGTCCCTCACATAGG - Intergenic
955187516 3:56729368-56729390 AGTCTGACTCACTGTCCGATTGG + Exonic
957093179 3:75752070-75752092 GGTCTGACTAACCCTCACATAGG + Intronic
961545184 3:127628698-127628720 AGTCTGGCTCAGGATCAGATTGG - Intergenic
961588721 3:127958535-127958557 GGTATCACTCAGGATCAGATGGG + Intronic
968610382 4:1554280-1554302 GGTCTGTCTCCCCATCACCTCGG + Intergenic
969207018 4:5654763-5654785 GGCCTGACTCAACAACAGAGTGG - Intronic
974699650 4:65424052-65424074 GGTGGGACTCACCATTAGAGTGG - Intronic
975871075 4:78778791-78778813 GGTCTGCCTGATCATAAGATTGG + Intronic
977120790 4:93098386-93098408 AGGCAGACTCACCATCAGAGAGG + Intronic
977517866 4:98044958-98044980 GGTCTGCCTCACCATGAGACAGG + Intronic
981366170 4:143906018-143906040 TGTGTGACTCACCATGAGTTTGG - Intergenic
981376285 4:144019798-144019820 TGTGTGACTCACCATGAGTTTGG - Intergenic
984751978 4:183286851-183286873 CTTCTGACTCTCAATCAGATGGG - Intronic
985931897 5:3064814-3064836 GCTCTGACACACCAGCAGAGTGG + Intergenic
986795878 5:11211380-11211402 GGACAGACTGACCATCAGCTAGG + Intronic
996697443 5:126414283-126414305 TGTCTGAATCACCCTCTGATAGG + Intronic
997417381 5:133739476-133739498 GATCTGACTCTCCCTCTGATTGG - Intergenic
1014022451 6:116606479-116606501 GCTCTTACTCACCGTAAGATAGG - Intergenic
1017873178 6:158503115-158503137 GCCCTGACTCAGCATCAGAGAGG - Exonic
1018460353 6:163992935-163992957 GCCCTGACTCAGAATCAGATGGG + Intergenic
1035107583 7:156455091-156455113 GTTCTGAGTCACAATCAGAAAGG - Intergenic
1037684958 8:21130762-21130784 GGTCTGATTCACCATCTGCTGGG - Intergenic
1047461535 8:125070293-125070315 TGTGTGACTCACAATCAGATAGG + Intronic
1047773330 8:128048599-128048621 GGTCTGACTCACCATCAGATGGG - Intergenic
1049151518 8:141038070-141038092 GTTCTGACTCATAACCAGATGGG - Intergenic
1050406102 9:5310002-5310024 GATGTGACTCACCTTAAGATTGG - Intergenic
1193923270 X:87455335-87455357 GGACTGTCTTGCCATCAGATGGG + Intergenic
1200410849 Y:2860004-2860026 AGCATGACTCATCATCAGATGGG + Intronic
1202050254 Y:20773477-20773499 GGCATGACTTATCATCAGATGGG + Intronic