ID: 1047773335

View in Genome Browser
Species Human (GRCh38)
Location 8:128048612-128048634
Sequence GAGTCAGACCTGCTGGGGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047773327_1047773335 11 Left 1047773327 8:128048578-128048600 CCAGAAGCTGGGATCAGCTTCCC 0: 1
1: 0
2: 0
3: 19
4: 184
Right 1047773335 8:128048612-128048634 GAGTCAGACCTGCTGGGGTTTGG No data
1047773325_1047773335 13 Left 1047773325 8:128048576-128048598 CCCCAGAAGCTGGGATCAGCTTC 0: 1
1: 1
2: 1
3: 19
4: 207
Right 1047773335 8:128048612-128048634 GAGTCAGACCTGCTGGGGTTTGG No data
1047773329_1047773335 -9 Left 1047773329 8:128048598-128048620 CCCCATCTGATGGTGAGTCAGAC 0: 1
1: 0
2: 0
3: 3
4: 81
Right 1047773335 8:128048612-128048634 GAGTCAGACCTGCTGGGGTTTGG No data
1047773323_1047773335 21 Left 1047773323 8:128048568-128048590 CCGATCCTCCCCAGAAGCTGGGA 0: 1
1: 3
2: 186
3: 3182
4: 5542
Right 1047773335 8:128048612-128048634 GAGTCAGACCTGCTGGGGTTTGG No data
1047773324_1047773335 16 Left 1047773324 8:128048573-128048595 CCTCCCCAGAAGCTGGGATCAGC 0: 1
1: 0
2: 9
3: 433
4: 11903
Right 1047773335 8:128048612-128048634 GAGTCAGACCTGCTGGGGTTTGG No data
1047773330_1047773335 -10 Left 1047773330 8:128048599-128048621 CCCATCTGATGGTGAGTCAGACC 0: 1
1: 0
2: 0
3: 8
4: 65
Right 1047773335 8:128048612-128048634 GAGTCAGACCTGCTGGGGTTTGG No data
1047773326_1047773335 12 Left 1047773326 8:128048577-128048599 CCCAGAAGCTGGGATCAGCTTCC 0: 1
1: 0
2: 0
3: 18
4: 208
Right 1047773335 8:128048612-128048634 GAGTCAGACCTGCTGGGGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047773335 Original CRISPR GAGTCAGACCTGCTGGGGTT TGG Intergenic
No off target data available for this crispr