ID: 1047773338

View in Genome Browser
Species Human (GRCh38)
Location 8:128048630-128048652
Sequence TTTGGGTCCTCGCTCCAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047773327_1047773338 29 Left 1047773327 8:128048578-128048600 CCAGAAGCTGGGATCAGCTTCCC 0: 1
1: 0
2: 0
3: 19
4: 184
Right 1047773338 8:128048630-128048652 TTTGGGTCCTCGCTCCAGCATGG No data
1047773329_1047773338 9 Left 1047773329 8:128048598-128048620 CCCCATCTGATGGTGAGTCAGAC 0: 1
1: 0
2: 0
3: 3
4: 81
Right 1047773338 8:128048630-128048652 TTTGGGTCCTCGCTCCAGCATGG No data
1047773331_1047773338 7 Left 1047773331 8:128048600-128048622 CCATCTGATGGTGAGTCAGACCT 0: 1
1: 1
2: 0
3: 9
4: 125
Right 1047773338 8:128048630-128048652 TTTGGGTCCTCGCTCCAGCATGG No data
1047773330_1047773338 8 Left 1047773330 8:128048599-128048621 CCCATCTGATGGTGAGTCAGACC 0: 1
1: 0
2: 0
3: 8
4: 65
Right 1047773338 8:128048630-128048652 TTTGGGTCCTCGCTCCAGCATGG No data
1047773326_1047773338 30 Left 1047773326 8:128048577-128048599 CCCAGAAGCTGGGATCAGCTTCC 0: 1
1: 0
2: 0
3: 18
4: 208
Right 1047773338 8:128048630-128048652 TTTGGGTCCTCGCTCCAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047773338 Original CRISPR TTTGGGTCCTCGCTCCAGCA TGG Intergenic
No off target data available for this crispr