ID: 1047773464

View in Genome Browser
Species Human (GRCh38)
Location 8:128049453-128049475
Sequence CTGTGGCTCTGTAGGGTGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047773456_1047773464 6 Left 1047773456 8:128049424-128049446 CCTAGCTGCAGCGTCAAGGTCTG No data
Right 1047773464 8:128049453-128049475 CTGTGGCTCTGTAGGGTGAAGGG No data
1047773452_1047773464 30 Left 1047773452 8:128049400-128049422 CCTTCTCTTGAGAGGCAGGCGGG No data
Right 1047773464 8:128049453-128049475 CTGTGGCTCTGTAGGGTGAAGGG No data
1047773455_1047773464 7 Left 1047773455 8:128049423-128049445 CCCTAGCTGCAGCGTCAAGGTCT No data
Right 1047773464 8:128049453-128049475 CTGTGGCTCTGTAGGGTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047773464 Original CRISPR CTGTGGCTCTGTAGGGTGAA GGG Intergenic
No off target data available for this crispr