ID: 1047774927

View in Genome Browser
Species Human (GRCh38)
Location 8:128062132-128062154
Sequence CCTTCCAGGCATTCACCAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047774927_1047774940 18 Left 1047774927 8:128062132-128062154 CCAACTGGTGAATGCCTGGAAGG No data
Right 1047774940 8:128062173-128062195 AGGGCTGCCCCCTGCGGTGCAGG No data
1047774927_1047774937 -2 Left 1047774927 8:128062132-128062154 CCAACTGGTGAATGCCTGGAAGG No data
Right 1047774937 8:128062153-128062175 GGGGTGATGGGGGCACTTGGAGG No data
1047774927_1047774943 21 Left 1047774927 8:128062132-128062154 CCAACTGGTGAATGCCTGGAAGG No data
Right 1047774943 8:128062176-128062198 GCTGCCCCCTGCGGTGCAGGGGG No data
1047774927_1047774941 19 Left 1047774927 8:128062132-128062154 CCAACTGGTGAATGCCTGGAAGG No data
Right 1047774941 8:128062174-128062196 GGGCTGCCCCCTGCGGTGCAGGG No data
1047774927_1047774939 12 Left 1047774927 8:128062132-128062154 CCAACTGGTGAATGCCTGGAAGG No data
Right 1047774939 8:128062167-128062189 ACTTGGAGGGCTGCCCCCTGCGG No data
1047774927_1047774936 -5 Left 1047774927 8:128062132-128062154 CCAACTGGTGAATGCCTGGAAGG No data
Right 1047774936 8:128062150-128062172 GAAGGGGTGATGGGGGCACTTGG No data
1047774927_1047774948 28 Left 1047774927 8:128062132-128062154 CCAACTGGTGAATGCCTGGAAGG No data
Right 1047774948 8:128062183-128062205 CCTGCGGTGCAGGGGGAGACAGG No data
1047774927_1047774938 -1 Left 1047774927 8:128062132-128062154 CCAACTGGTGAATGCCTGGAAGG No data
Right 1047774938 8:128062154-128062176 GGGTGATGGGGGCACTTGGAGGG No data
1047774927_1047774942 20 Left 1047774927 8:128062132-128062154 CCAACTGGTGAATGCCTGGAAGG No data
Right 1047774942 8:128062175-128062197 GGCTGCCCCCTGCGGTGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047774927 Original CRISPR CCTTCCAGGCATTCACCAGT TGG (reversed) Intergenic
No off target data available for this crispr