ID: 1047775254

View in Genome Browser
Species Human (GRCh38)
Location 8:128065135-128065157
Sequence GCATGTGCATGCGTGTGCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047775251_1047775254 19 Left 1047775251 8:128065093-128065115 CCTGAAGAGGCCAGACTAGAGTG No data
Right 1047775254 8:128065135-128065157 GCATGTGCATGCGTGTGCAAGGG No data
1047775252_1047775254 9 Left 1047775252 8:128065103-128065125 CCAGACTAGAGTGAAGCATTTAC No data
Right 1047775254 8:128065135-128065157 GCATGTGCATGCGTGTGCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047775254 Original CRISPR GCATGTGCATGCGTGTGCAA GGG Intergenic
No off target data available for this crispr