ID: 1047777857

View in Genome Browser
Species Human (GRCh38)
Location 8:128088389-128088411
Sequence CACTTTCAGCAGCAGCAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047777853_1047777857 -2 Left 1047777853 8:128088368-128088390 CCTTGGCTGCTGGTTTACCTTCA No data
Right 1047777857 8:128088389-128088411 CACTTTCAGCAGCAGCAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047777857 Original CRISPR CACTTTCAGCAGCAGCAGAG GGG Intergenic
No off target data available for this crispr