ID: 1047779501

View in Genome Browser
Species Human (GRCh38)
Location 8:128099961-128099983
Sequence AAACCCACCCTGCGGCTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047779501_1047779504 -7 Left 1047779501 8:128099961-128099983 CCAGCCAGCCGCAGGGTGGGTTT No data
Right 1047779504 8:128099977-128099999 TGGGTTTGTTCATTGATTGATGG No data
1047779501_1047779510 12 Left 1047779501 8:128099961-128099983 CCAGCCAGCCGCAGGGTGGGTTT No data
Right 1047779510 8:128099996-128100018 ATGGCTGTATGGGGTGGAGGAGG No data
1047779501_1047779508 6 Left 1047779501 8:128099961-128099983 CCAGCCAGCCGCAGGGTGGGTTT No data
Right 1047779508 8:128099990-128100012 TGATTGATGGCTGTATGGGGTGG No data
1047779501_1047779511 13 Left 1047779501 8:128099961-128099983 CCAGCCAGCCGCAGGGTGGGTTT No data
Right 1047779511 8:128099997-128100019 TGGCTGTATGGGGTGGAGGAGGG No data
1047779501_1047779505 1 Left 1047779501 8:128099961-128099983 CCAGCCAGCCGCAGGGTGGGTTT No data
Right 1047779505 8:128099985-128100007 TTCATTGATTGATGGCTGTATGG No data
1047779501_1047779506 2 Left 1047779501 8:128099961-128099983 CCAGCCAGCCGCAGGGTGGGTTT No data
Right 1047779506 8:128099986-128100008 TCATTGATTGATGGCTGTATGGG No data
1047779501_1047779509 9 Left 1047779501 8:128099961-128099983 CCAGCCAGCCGCAGGGTGGGTTT No data
Right 1047779509 8:128099993-128100015 TTGATGGCTGTATGGGGTGGAGG No data
1047779501_1047779507 3 Left 1047779501 8:128099961-128099983 CCAGCCAGCCGCAGGGTGGGTTT No data
Right 1047779507 8:128099987-128100009 CATTGATTGATGGCTGTATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047779501 Original CRISPR AAACCCACCCTGCGGCTGGC TGG (reversed) Intergenic
No off target data available for this crispr