ID: 1047783057

View in Genome Browser
Species Human (GRCh38)
Location 8:128125542-128125564
Sequence CCCAGGACGTGCCTGGCTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047783057_1047783062 -10 Left 1047783057 8:128125542-128125564 CCCAAAGCCAGGCACGTCCTGGG No data
Right 1047783062 8:128125555-128125577 ACGTCCTGGGTTGGACACACCGG No data
1047783057_1047783066 3 Left 1047783057 8:128125542-128125564 CCCAAAGCCAGGCACGTCCTGGG No data
Right 1047783066 8:128125568-128125590 GACACACCGGGAGACTTGAAGGG No data
1047783057_1047783068 7 Left 1047783057 8:128125542-128125564 CCCAAAGCCAGGCACGTCCTGGG No data
Right 1047783068 8:128125572-128125594 CACCGGGAGACTTGAAGGGGAGG No data
1047783057_1047783063 -9 Left 1047783057 8:128125542-128125564 CCCAAAGCCAGGCACGTCCTGGG No data
Right 1047783063 8:128125556-128125578 CGTCCTGGGTTGGACACACCGGG No data
1047783057_1047783065 2 Left 1047783057 8:128125542-128125564 CCCAAAGCCAGGCACGTCCTGGG No data
Right 1047783065 8:128125567-128125589 GGACACACCGGGAGACTTGAAGG No data
1047783057_1047783067 4 Left 1047783057 8:128125542-128125564 CCCAAAGCCAGGCACGTCCTGGG No data
Right 1047783067 8:128125569-128125591 ACACACCGGGAGACTTGAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047783057 Original CRISPR CCCAGGACGTGCCTGGCTTT GGG (reversed) Intergenic
No off target data available for this crispr