ID: 1047783900

View in Genome Browser
Species Human (GRCh38)
Location 8:128135002-128135024
Sequence CAGGATGGCCCCTTTGTAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047783900_1047783905 24 Left 1047783900 8:128135002-128135024 CCTACTACAAAGGGGCCATCCTG No data
Right 1047783905 8:128135049-128135071 ATAAAGTTTTATCCTGAGCAGGG No data
1047783900_1047783904 23 Left 1047783900 8:128135002-128135024 CCTACTACAAAGGGGCCATCCTG No data
Right 1047783904 8:128135048-128135070 AATAAAGTTTTATCCTGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047783900 Original CRISPR CAGGATGGCCCCTTTGTAGT AGG (reversed) Intergenic
No off target data available for this crispr