ID: 1047785598

View in Genome Browser
Species Human (GRCh38)
Location 8:128151406-128151428
Sequence CTTTCCTACTCAGAGACTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047785598_1047785601 19 Left 1047785598 8:128151406-128151428 CCACCAGTCTCTGAGTAGGAAAG No data
Right 1047785601 8:128151448-128151470 TTTTGGAAAGAACATTTGTGTGG No data
1047785598_1047785600 2 Left 1047785598 8:128151406-128151428 CCACCAGTCTCTGAGTAGGAAAG No data
Right 1047785600 8:128151431-128151453 ACACAGTCTGATTTGCATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047785598 Original CRISPR CTTTCCTACTCAGAGACTGG TGG (reversed) Intergenic
No off target data available for this crispr