ID: 1047787683

View in Genome Browser
Species Human (GRCh38)
Location 8:128169495-128169517
Sequence TTTCTAGGCTCTGGCCCCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047787683_1047787686 0 Left 1047787683 8:128169495-128169517 CCTTTGGGGCCAGAGCCTAGAAA No data
Right 1047787686 8:128169518-128169540 TCATTCTGCTTTGCCTACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047787683 Original CRISPR TTTCTAGGCTCTGGCCCCAA AGG (reversed) Intergenic
No off target data available for this crispr