ID: 1047787686

View in Genome Browser
Species Human (GRCh38)
Location 8:128169518-128169540
Sequence TCATTCTGCTTTGCCTACCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047787683_1047787686 0 Left 1047787683 8:128169495-128169517 CCTTTGGGGCCAGAGCCTAGAAA No data
Right 1047787686 8:128169518-128169540 TCATTCTGCTTTGCCTACCAAGG No data
1047787684_1047787686 -9 Left 1047787684 8:128169504-128169526 CCAGAGCCTAGAAATCATTCTGC No data
Right 1047787686 8:128169518-128169540 TCATTCTGCTTTGCCTACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047787686 Original CRISPR TCATTCTGCTTTGCCTACCA AGG Intergenic
No off target data available for this crispr