ID: 1047791842

View in Genome Browser
Species Human (GRCh38)
Location 8:128211235-128211257
Sequence AGGGAGAAACTATATGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047791841_1047791842 -5 Left 1047791841 8:128211217-128211239 CCATAGAAAGCTCAGAGGAGGGA No data
Right 1047791842 8:128211235-128211257 AGGGAGAAACTATATGAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047791842 Original CRISPR AGGGAGAAACTATATGAAGC TGG Intergenic
No off target data available for this crispr