ID: 1047795053

View in Genome Browser
Species Human (GRCh38)
Location 8:128246917-128246939
Sequence AAGCTGTTCTAAGGAAGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047795053_1047795055 -5 Left 1047795053 8:128246917-128246939 CCTTGGCTTCCTTAGAACAGCTT No data
Right 1047795055 8:128246935-128246957 AGCTTTCTGTCATGTAGAGCAGG No data
1047795053_1047795057 -3 Left 1047795053 8:128246917-128246939 CCTTGGCTTCCTTAGAACAGCTT No data
Right 1047795057 8:128246937-128246959 CTTTCTGTCATGTAGAGCAGGGG No data
1047795053_1047795056 -4 Left 1047795053 8:128246917-128246939 CCTTGGCTTCCTTAGAACAGCTT No data
Right 1047795056 8:128246936-128246958 GCTTTCTGTCATGTAGAGCAGGG No data
1047795053_1047795059 21 Left 1047795053 8:128246917-128246939 CCTTGGCTTCCTTAGAACAGCTT No data
Right 1047795059 8:128246961-128246983 CACCCCAGAACACACAGCTCTGG No data
1047795053_1047795063 27 Left 1047795053 8:128246917-128246939 CCTTGGCTTCCTTAGAACAGCTT No data
Right 1047795063 8:128246967-128246989 AGAACACACAGCTCTGGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047795053 Original CRISPR AAGCTGTTCTAAGGAAGCCA AGG (reversed) Intergenic
No off target data available for this crispr