ID: 1047796647

View in Genome Browser
Species Human (GRCh38)
Location 8:128263609-128263631
Sequence CTGATCTTTTAGGGCATTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047796643_1047796647 11 Left 1047796643 8:128263575-128263597 CCTTGGGGGATTAAGATGTTGGC No data
Right 1047796647 8:128263609-128263631 CTGATCTTTTAGGGCATTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047796647 Original CRISPR CTGATCTTTTAGGGCATTTA AGG Intergenic
No off target data available for this crispr