ID: 1047798528

View in Genome Browser
Species Human (GRCh38)
Location 8:128284254-128284276
Sequence CGGTACCTTCTCCCCTGCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047798528_1047798533 -5 Left 1047798528 8:128284254-128284276 CCAATGCAGGGGAGAAGGTACCG No data
Right 1047798533 8:128284272-128284294 TACCGGATGGTGAGATCAAGGGG No data
1047798528_1047798535 3 Left 1047798528 8:128284254-128284276 CCAATGCAGGGGAGAAGGTACCG No data
Right 1047798535 8:128284280-128284302 GGTGAGATCAAGGGGTTCTGAGG No data
1047798528_1047798531 -7 Left 1047798528 8:128284254-128284276 CCAATGCAGGGGAGAAGGTACCG No data
Right 1047798531 8:128284270-128284292 GGTACCGGATGGTGAGATCAAGG No data
1047798528_1047798532 -6 Left 1047798528 8:128284254-128284276 CCAATGCAGGGGAGAAGGTACCG No data
Right 1047798532 8:128284271-128284293 GTACCGGATGGTGAGATCAAGGG No data
1047798528_1047798536 13 Left 1047798528 8:128284254-128284276 CCAATGCAGGGGAGAAGGTACCG No data
Right 1047798536 8:128284290-128284312 AGGGGTTCTGAGGTTTTTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047798528 Original CRISPR CGGTACCTTCTCCCCTGCAT TGG (reversed) Intergenic
No off target data available for this crispr