ID: 1047798531

View in Genome Browser
Species Human (GRCh38)
Location 8:128284270-128284292
Sequence GGTACCGGATGGTGAGATCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047798528_1047798531 -7 Left 1047798528 8:128284254-128284276 CCAATGCAGGGGAGAAGGTACCG No data
Right 1047798531 8:128284270-128284292 GGTACCGGATGGTGAGATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047798531 Original CRISPR GGTACCGGATGGTGAGATCA AGG Intergenic
No off target data available for this crispr