ID: 1047798532

View in Genome Browser
Species Human (GRCh38)
Location 8:128284271-128284293
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047798528_1047798532 -6 Left 1047798528 8:128284254-128284276 CCAATGCAGGGGAGAAGGTACCG No data
Right 1047798532 8:128284271-128284293 GTACCGGATGGTGAGATCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047798532 Original CRISPR GTACCGGATGGTGAGATCAA GGG Intergenic
No off target data available for this crispr