ID: 1047798534

View in Genome Browser
Species Human (GRCh38)
Location 8:128284274-128284296
Sequence AACCCCTTGATCTCACCATC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047798534_1047798536 -7 Left 1047798534 8:128284274-128284296 CCGGATGGTGAGATCAAGGGGTT No data
Right 1047798536 8:128284290-128284312 AGGGGTTCTGAGGTTTTTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047798534 Original CRISPR AACCCCTTGATCTCACCATC CGG (reversed) Intergenic
No off target data available for this crispr