ID: 1047799846

View in Genome Browser
Species Human (GRCh38)
Location 8:128297426-128297448
Sequence ATGGCCGAGGTGAATGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047799846_1047799849 15 Left 1047799846 8:128297426-128297448 CCATCTTCATTCACCTCGGCCAT No data
Right 1047799849 8:128297464-128297486 ACTGATTTCTCACCTTCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047799846 Original CRISPR ATGGCCGAGGTGAATGAAGA TGG (reversed) Intergenic
No off target data available for this crispr