ID: 1047801897

View in Genome Browser
Species Human (GRCh38)
Location 8:128318782-128318804
Sequence CCACGCTGCCTGGGAAGAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047801886_1047801897 25 Left 1047801886 8:128318734-128318756 CCCAAGAAAACCTCTGAATTTTC No data
Right 1047801897 8:128318782-128318804 CCACGCTGCCTGGGAAGAAGGGG No data
1047801887_1047801897 24 Left 1047801887 8:128318735-128318757 CCAAGAAAACCTCTGAATTTTCC No data
Right 1047801897 8:128318782-128318804 CCACGCTGCCTGGGAAGAAGGGG No data
1047801885_1047801897 26 Left 1047801885 8:128318733-128318755 CCCCAAGAAAACCTCTGAATTTT No data
Right 1047801897 8:128318782-128318804 CCACGCTGCCTGGGAAGAAGGGG No data
1047801890_1047801897 3 Left 1047801890 8:128318756-128318778 CCACTGTTAGCAGCAATGGACAG No data
Right 1047801897 8:128318782-128318804 CCACGCTGCCTGGGAAGAAGGGG No data
1047801888_1047801897 15 Left 1047801888 8:128318744-128318766 CCTCTGAATTTTCCACTGTTAGC No data
Right 1047801897 8:128318782-128318804 CCACGCTGCCTGGGAAGAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047801897 Original CRISPR CCACGCTGCCTGGGAAGAAG GGG Intergenic
No off target data available for this crispr