ID: 1047802268

View in Genome Browser
Species Human (GRCh38)
Location 8:128322402-128322424
Sequence GATACACTGGTGACCAGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047802268_1047802273 29 Left 1047802268 8:128322402-128322424 CCTGTCCTGGTCACCAGTGTATC No data
Right 1047802273 8:128322454-128322476 CTAAATGCCTAACAACCACATGG No data
1047802268_1047802272 4 Left 1047802268 8:128322402-128322424 CCTGTCCTGGTCACCAGTGTATC No data
Right 1047802272 8:128322429-128322451 AAGTACTCATGTGCTTAATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047802268 Original CRISPR GATACACTGGTGACCAGGAC AGG (reversed) Intergenic
No off target data available for this crispr