ID: 1047802272

View in Genome Browser
Species Human (GRCh38)
Location 8:128322429-128322451
Sequence AAGTACTCATGTGCTTAATT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047802268_1047802272 4 Left 1047802268 8:128322402-128322424 CCTGTCCTGGTCACCAGTGTATC No data
Right 1047802272 8:128322429-128322451 AAGTACTCATGTGCTTAATTAGG No data
1047802266_1047802272 24 Left 1047802266 8:128322382-128322404 CCTGCTCTGCAAGAGAAGGGCCT No data
Right 1047802272 8:128322429-128322451 AAGTACTCATGTGCTTAATTAGG No data
1047802269_1047802272 -1 Left 1047802269 8:128322407-128322429 CCTGGTCACCAGTGTATCCTTTA No data
Right 1047802272 8:128322429-128322451 AAGTACTCATGTGCTTAATTAGG No data
1047802270_1047802272 -9 Left 1047802270 8:128322415-128322437 CCAGTGTATCCTTTAAGTACTCA No data
Right 1047802272 8:128322429-128322451 AAGTACTCATGTGCTTAATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047802272 Original CRISPR AAGTACTCATGTGCTTAATT AGG Intergenic
No off target data available for this crispr