ID: 1047802273

View in Genome Browser
Species Human (GRCh38)
Location 8:128322454-128322476
Sequence CTAAATGCCTAACAACCACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047802269_1047802273 24 Left 1047802269 8:128322407-128322429 CCTGGTCACCAGTGTATCCTTTA No data
Right 1047802273 8:128322454-128322476 CTAAATGCCTAACAACCACATGG No data
1047802271_1047802273 7 Left 1047802271 8:128322424-128322446 CCTTTAAGTACTCATGTGCTTAA No data
Right 1047802273 8:128322454-128322476 CTAAATGCCTAACAACCACATGG No data
1047802268_1047802273 29 Left 1047802268 8:128322402-128322424 CCTGTCCTGGTCACCAGTGTATC No data
Right 1047802273 8:128322454-128322476 CTAAATGCCTAACAACCACATGG No data
1047802270_1047802273 16 Left 1047802270 8:128322415-128322437 CCAGTGTATCCTTTAAGTACTCA No data
Right 1047802273 8:128322454-128322476 CTAAATGCCTAACAACCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047802273 Original CRISPR CTAAATGCCTAACAACCACA TGG Intergenic
No off target data available for this crispr