ID: 1047809248

View in Genome Browser
Species Human (GRCh38)
Location 8:128390457-128390479
Sequence TTCCATGGCAACAGAGTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047809245_1047809248 18 Left 1047809245 8:128390416-128390438 CCTCTGGAAGGAAGGCTGTGTTT No data
Right 1047809248 8:128390457-128390479 TTCCATGGCAACAGAGTGTCTGG No data
1047809243_1047809248 26 Left 1047809243 8:128390408-128390430 CCTCTGCACCTCTGGAAGGAAGG No data
Right 1047809248 8:128390457-128390479 TTCCATGGCAACAGAGTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047809248 Original CRISPR TTCCATGGCAACAGAGTGTC TGG Intergenic
No off target data available for this crispr