ID: 1047810654

View in Genome Browser
Species Human (GRCh38)
Location 8:128405312-128405334
Sequence CTACTTCTCCAGTTCTCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047810654_1047810662 7 Left 1047810654 8:128405312-128405334 CCTCCAGAGAACTGGAGAAGTAG No data
Right 1047810662 8:128405342-128405364 CAAGGAAGAAAGGCAATCAAGGG No data
1047810654_1047810660 -3 Left 1047810654 8:128405312-128405334 CCTCCAGAGAACTGGAGAAGTAG No data
Right 1047810660 8:128405332-128405354 TAGGACAGGGCAAGGAAGAAAGG No data
1047810654_1047810661 6 Left 1047810654 8:128405312-128405334 CCTCCAGAGAACTGGAGAAGTAG No data
Right 1047810661 8:128405341-128405363 GCAAGGAAGAAAGGCAATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047810654 Original CRISPR CTACTTCTCCAGTTCTCTGG AGG (reversed) Intergenic
No off target data available for this crispr