ID: 1047812102

View in Genome Browser
Species Human (GRCh38)
Location 8:128422100-128422122
Sequence GCATTTAAACTGATGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047812099_1047812102 -1 Left 1047812099 8:128422078-128422100 CCTTGAATCTGTTTTTCTTGATG No data
Right 1047812102 8:128422100-128422122 GCATTTAAACTGATGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047812102 Original CRISPR GCATTTAAACTGATGGTGGA AGG Intergenic
No off target data available for this crispr