ID: 1047812141

View in Genome Browser
Species Human (GRCh38)
Location 8:128422466-128422488
Sequence GTGCTCCTTCACTGATGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047812141_1047812150 27 Left 1047812141 8:128422466-128422488 CCCTGGCATCAGTGAAGGAGCAC No data
Right 1047812150 8:128422516-128422538 TGCTAGGAACAAACAGTGCTAGG No data
1047812141_1047812149 11 Left 1047812141 8:128422466-128422488 CCCTGGCATCAGTGAAGGAGCAC No data
Right 1047812149 8:128422500-128422522 GGGATTGGCTCTGGTGTGCTAGG No data
1047812141_1047812143 -10 Left 1047812141 8:128422466-128422488 CCCTGGCATCAGTGAAGGAGCAC No data
Right 1047812143 8:128422479-128422501 GAAGGAGCACCATTTCCTGCAGG No data
1047812141_1047812147 2 Left 1047812141 8:128422466-128422488 CCCTGGCATCAGTGAAGGAGCAC No data
Right 1047812147 8:128422491-128422513 TTTCCTGCAGGGATTGGCTCTGG No data
1047812141_1047812145 -4 Left 1047812141 8:128422466-128422488 CCCTGGCATCAGTGAAGGAGCAC No data
Right 1047812145 8:128422485-128422507 GCACCATTTCCTGCAGGGATTGG No data
1047812141_1047812144 -9 Left 1047812141 8:128422466-128422488 CCCTGGCATCAGTGAAGGAGCAC No data
Right 1047812144 8:128422480-128422502 AAGGAGCACCATTTCCTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047812141 Original CRISPR GTGCTCCTTCACTGATGCCA GGG (reversed) Intergenic
No off target data available for this crispr