ID: 1047813443

View in Genome Browser
Species Human (GRCh38)
Location 8:128435608-128435630
Sequence TAGGAGGCCCACTGGGGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047813443_1047813450 4 Left 1047813443 8:128435608-128435630 CCTTTTCCCCAGTGGGCCTCCTA No data
Right 1047813450 8:128435635-128435657 TCCAGTATTTCATGCCAACAGGG No data
1047813443_1047813449 3 Left 1047813443 8:128435608-128435630 CCTTTTCCCCAGTGGGCCTCCTA No data
Right 1047813449 8:128435634-128435656 GTCCAGTATTTCATGCCAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047813443 Original CRISPR TAGGAGGCCCACTGGGGAAA AGG (reversed) Intergenic
No off target data available for this crispr