ID: 1047818413

View in Genome Browser
Species Human (GRCh38)
Location 8:128490740-128490762
Sequence GCTTCTCTAGGCCATGCGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047818410_1047818413 22 Left 1047818410 8:128490695-128490717 CCACTGCATGAGAACAGTGTAAC No data
Right 1047818413 8:128490740-128490762 GCTTCTCTAGGCCATGCGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047818413 Original CRISPR GCTTCTCTAGGCCATGCGTG TGG Intergenic
No off target data available for this crispr