ID: 1047819139

View in Genome Browser
Species Human (GRCh38)
Location 8:128499429-128499451
Sequence TGTTATGAGAATACAGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047819139_1047819142 11 Left 1047819139 8:128499429-128499451 CCCTCCTCTGTATTCTCATAACA No data
Right 1047819142 8:128499463-128499485 CATCTATTGTAGCACTTAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047819139 Original CRISPR TGTTATGAGAATACAGAGGA GGG (reversed) Intergenic
No off target data available for this crispr