ID: 1047819142

View in Genome Browser
Species Human (GRCh38)
Location 8:128499463-128499485
Sequence CATCTATTGTAGCACTTAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047819141_1047819142 7 Left 1047819141 8:128499433-128499455 CCTCTGTATTCTCATAACACTCT No data
Right 1047819142 8:128499463-128499485 CATCTATTGTAGCACTTAAGAGG No data
1047819137_1047819142 29 Left 1047819137 8:128499411-128499433 CCCAGAGGAATAAATGCTCCCTC No data
Right 1047819142 8:128499463-128499485 CATCTATTGTAGCACTTAAGAGG No data
1047819138_1047819142 28 Left 1047819138 8:128499412-128499434 CCAGAGGAATAAATGCTCCCTCC No data
Right 1047819142 8:128499463-128499485 CATCTATTGTAGCACTTAAGAGG No data
1047819140_1047819142 10 Left 1047819140 8:128499430-128499452 CCTCCTCTGTATTCTCATAACAC No data
Right 1047819142 8:128499463-128499485 CATCTATTGTAGCACTTAAGAGG No data
1047819139_1047819142 11 Left 1047819139 8:128499429-128499451 CCCTCCTCTGTATTCTCATAACA No data
Right 1047819142 8:128499463-128499485 CATCTATTGTAGCACTTAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047819142 Original CRISPR CATCTATTGTAGCACTTAAG AGG Intergenic
No off target data available for this crispr