ID: 1047820223

View in Genome Browser
Species Human (GRCh38)
Location 8:128511166-128511188
Sequence ATTCACATGGTGCTGAAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047820223_1047820226 2 Left 1047820223 8:128511166-128511188 CCCATTTTCAGCACCATGTGAAT No data
Right 1047820226 8:128511191-128511213 AGAATTGTTGACTTTCAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047820223 Original CRISPR ATTCACATGGTGCTGAAAAT GGG (reversed) Intergenic
No off target data available for this crispr