ID: 1047822794

View in Genome Browser
Species Human (GRCh38)
Location 8:128539885-128539907
Sequence GAGGGGTGACGTTTGATCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047822790_1047822794 -6 Left 1047822790 8:128539868-128539890 CCAGGGAAAGCCCTTCTGAGGGG No data
Right 1047822794 8:128539885-128539907 GAGGGGTGACGTTTGATCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047822794 Original CRISPR GAGGGGTGACGTTTGATCAG AGG Intergenic
No off target data available for this crispr