ID: 1047823976

View in Genome Browser
Species Human (GRCh38)
Location 8:128553068-128553090
Sequence GACTCACAGTTCCACGTGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 22098
Summary {0: 36, 1: 862, 2: 5111, 3: 8006, 4: 8083}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047823973_1047823976 17 Left 1047823973 8:128553028-128553050 CCTGAGACTGGGTGATTTATAAT 0: 5
1: 405
2: 7926
3: 14471
4: 15087
Right 1047823976 8:128553068-128553090 GACTCACAGTTCCACGTGACTGG 0: 36
1: 862
2: 5111
3: 8006
4: 8083

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047823976 Original CRISPR GACTCACAGTTCCACGTGAC TGG Intergenic
Too many off-targets to display for this crispr