ID: 1047826092

View in Genome Browser
Species Human (GRCh38)
Location 8:128577385-128577407
Sequence CTACCTCATGCTGTTGTAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047826092_1047826094 8 Left 1047826092 8:128577385-128577407 CCTATTACAACAGCATGAGGTAG No data
Right 1047826094 8:128577416-128577438 ATTGCCTTTTTATAAAAAGATGG No data
1047826092_1047826096 15 Left 1047826092 8:128577385-128577407 CCTATTACAACAGCATGAGGTAG No data
Right 1047826096 8:128577423-128577445 TTTTATAAAAAGATGGAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047826092 Original CRISPR CTACCTCATGCTGTTGTAAT AGG (reversed) Intergenic
No off target data available for this crispr